Top » Catalog » SNPs » Z73

$15.00

Z73
[Z73]

Z73
hg38 Position: ChrY:13112677..13112677
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: I1a2a1b
Comments: I1. parallel to L22. Z62. downstream of Z60. Z61
Forward Primer: Z73_F CTTTTAATGTGGGGTGGTCCC
Reverse Primer: Z73_R CTTATTCTGGCCAAAGACAGGTAGACG
Reviews

Customers who bought this product also purchased
Z2041
Z2041
S4715
S4715
Z140
Z140
L1248
L1248
FGC22162
FGC22162
Z2539
Z2539
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies