Top » Catalog » SNPs » Z73

$18.00

Z73
[Z73]

Z73
hg38 Position: ChrY:13112677..13112677
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: I1a2a1b
Comments: I1. parallel to L22. Z62. downstream of Z60. Z61
Forward Primer: Z73_F CTTTTAATGTGGGGTGGTCCC
Reverse Primer: Z73_R CTTATTCTGGCCAAAGACAGGTAGACG
Reviews

Customers who bought this product also purchased
L1302
L1302
S11132
S11132
I1 Superclade Panel
I1 Superclade Panel
I1-Z2539 (including L1302) Panel
I1-Z2539 (including L1302) Panel
Y21567
Y21567
Z2041
Z2041
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC32407
$18.00
Haplogroup Info
Other products
Currencies