Top » Catalog » SNPs » Z73

$18.00

Z73
[Z73]

Z73
hg38 Position: ChrY:13112677..13112677
Ancestral: G
Derived: A
Reference: http://dna-forums.org/
ISOGG Haplogroup: I1a2a1b
Comments: I1. parallel to L22. Z62. downstream of Z60. Z61
Forward Primer: Z73_F CTTTTAATGTGGGGTGGTCCC
Reverse Primer: Z73_R CTTATTCTGGCCAAAGACAGGTAGACG
Reviews

Customers who bought this product also purchased
S2122
S2122
Z62
Z62
Y25790
Y25790
BY479
BY479
Z2900
Z2900
BY232
BY232
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies