Top » Catalog » SNPs » FGC14522

$18.00

FGC14522
[FGC14522]

FGC14522
hg38 Position: ChrY:8641351..8641351
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: G2a2b2a1a1b1a2a1b
Comments: Below Z726 > S2808
Forward Primer: FGC14522_F AAGGAACAATAGGAGTGCAAGTC
Reverse Primer: FGC14522_R ACAAAGGCCAGACACACCTC
Reviews

Customers who bought this product also purchased
Z39561
Z39561
Z16775
Z16775
Z29315
Z29315
Z41144
Z41144
S18765
S18765
Z45473
Z45473
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies