Top » Catalog » SNPs » FGC14522

$18.00

FGC14522
[FGC14522]

FGC14522
HG19 Position: ChrY:8641351..8641351
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: G2a2b2a1a1b1a2a1b
Comments: Below Z726 > S2808
Forward Primer: FGC14522_F AAGGAACAATAGGAGTGCAAGTC
Reverse Primer: FGC14522_R ACAAAGGCCAGACACACCTC
Reviews

Customers who bought this product also purchased
Z726
Z726
Z725
Z725
G2a-L497 Panel
G2a-L497 Panel
S2784
S2784
Z30739
Z30739
Z30729
Z30729
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies