Top » Catalog » SNPs » FGC5235

$18.00

FGC5235
[FGC5235]

FGC5235
hg38 Position: ChrY:16592409..16592409
Ancestral: G
Derived: A
Reference: Full Genomes Corp (2013)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC5235_F TGGAAACCACACTCATGGTC
Reverse Primer: FGC5235_R TTACCCAATGACCCAGGTTG
Reviews

Customers who bought this product also purchased
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
FGC1695
FGC1695
L174
L174
FGC12
FGC12
ZS1409
ZS1409
DYS454
DYS454
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies