Top » Catalog » SNPs » FGC59170

$18.00

FGC59170
[FGC59170]

FGC59170
hg38 Position: ChrY:6821818..6821818
Ancestral: ins
Derived: del
Reference: Full Genomes Corp (2017)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC59170_F TGTTCCATTTGAGGAACAATCC
Reverse Primer: FGC59170_R AACAAGCCTAAGTGCCATTAACC
Reviews

Customers who bought this product also purchased
Z2293
Z2293
L858
L858
BY74
BY74
FGC1707
FGC1707
FGC5230
FGC5230
FGC11
FGC11
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies