Top » Catalog » SNPs » Y16563

$18.00

Y16563
[Y16563]

Y16563
hg38 Position: ChrY:8484582..8484582
Ancestral: G
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V22 > L674 > Y16549
Forward Primer: Y16563_F GCAATATGGATGACATACAGCAC
Reverse Primer: Y16563_R CTACTACAAATGACCAGTTGCTTCTC
Reviews

Customers who bought this product also purchased
CTS4089
CTS4089
BY7446
BY7446
FGC92599
FGC92599
Y133046
Y133046
Z834
Z834
FGC2739
FGC2739
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies