Top » Catalog » SNPs » Y16563

$18.00

Y16563
[Y16563]

Y16563
hg38 Position: ChrY:8484582..8484582
Ancestral: G
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V22 > L674 > Y16549
Forward Primer: Y16563_F GCAATATGGATGACATACAGCAC
Reverse Primer: Y16563_R CTACTACAAATGACCAGTTGCTTCTC
Reviews

Customers who bought this product also purchased
S3003
S3003
Z827
Z827
M35.2
M35.2
M35
M35
BY10366
BY10366
Z5018
Z5018
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies