Top » Catalog » SNPs » Y16563

$18.00

Y16563
[Y16563]

Y16563
hg38 Position: ChrY:8484582..8484582
Ancestral: G
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V22 > L674 > Y16549
Forward Primer: Y16563_F GCAATATGGATGACATACAGCAC
Reverse Primer: Y16563_R CTACTACAAATGACCAGTTGCTTCTC
Reviews

Customers who bought this product also purchased
V13
V13
FGC37187
FGC37187
L335
L335
BY6712
BY6712
M78
M78
BY6697
BY6697
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies