Top » Catalog » SNPs » Y16563

$18.00

Y16563
[Y16563]

Y16563
hg38 Position: ChrY:8484582..8484582
Ancestral: G
Derived: T
Reference: YFull (2015)
ISOGG Haplogroup: E1b (not listed)
Comments: Below V22 > L674 > Y16549
Forward Primer: Y16563_F GCAATATGGATGACATACAGCAC
Reverse Primer: Y16563_R CTACTACAAATGACCAGTTGCTTCTC
Reviews

Customers who bought this product also purchased
Z5017
Z5017
Z1057
Z1057
PH2818
PH2818
E1b-V13 Panel
E1b-V13 Panel
CTS5856
CTS5856
Z1902
Z1902
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies