Top » Catalog » SNPs » FGC16722

$18.00

FGC16722
[FGC16722]

FGC16722
hg38 Position: ChrY:13480787..13480787
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: J1a
Comments: Below FGC6 > FGC4230
Forward Primer: FGC16722_F GGAATCAACGTGGCAACTG
Reverse Primer: FGC16722_R CCACCTTGGGCAAATGTATC
Reviews

Customers who bought this product also purchased
J1-M267 Superclade Panel
J1-M267 Superclade Panel
DYS723
DYS723
DYR112
DYR112
DYS713
DYS713
DYR76
DYR76
DYS711
DYS711
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies