Top » Catalog » SNPs » Z17887

$18.00

Z17887
[Z17887]

Z17887
hg38 Position: ChrY:14367901..14367901
Ancestral: C
Derived: G
Reference: Greg Magoon et al. (2014)
ISOGG Haplogroup: G2a2b1a1b
Comments: Below M406
Forward Primer: Z17887_F GACTCTGGCTGATGGGACTC
Reverse Primer: Z17887_R ATGTTTGTTGGCACGTTGAG
Reviews

Customers who bought this product also purchased
M406
M406
L497
L497
PF3180
PF3180
L1259
L1259
U8
U8
M201
M201
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies