Top » Catalog » SNPs » Z17887

$18.00

Z17887
[Z17887]

Z17887
hg38 Position: ChrY:14367901..14367901
Ancestral: C
Derived: G
Reference: Greg Magoon et al. (2014)
ISOGG Haplogroup: G2a2b1a1b
Comments: Below M406
Forward Primer: Z17887_F GACTCTGGCTGATGGGACTC
Reverse Primer: Z17887_R ATGTTTGTTGGCACGTTGAG
Reviews

Customers who bought this product also purchased
L140
L140
Z37368
Z37368
G Superclade Panel
G Superclade Panel
G2a-L1259 Panel
G2a-L1259 Panel
FGC5081
FGC5081
Z6552
Z6552
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies