Top » Catalog » SNPs » A15054

$18.00

A15054
[A15054]

A15054
hg38 Position: ChrY:8718971..8718973
Ancestral: ins
Derived: del
Reference: Ray Warburton (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A15054_F GCTGGGAAGTGAATTCAAGG
Reverse Primer: A15054_R TGTGGCATTGTTTGTGTGTG
Reviews

Customers who bought this product also purchased
A15055
A15055
A11378
A11378
A15060
A15060
R1b-A11378 Panel
R1b-A11378 Panel
A15058
A15058
A15057
A15057
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies