Top » Catalog » SNPs » A15057

$18.00

A15057
[A15057]

A15057
hg38 Position: ChrY:14665456..14665456
Ancestral: G
Derived: T
Reference: Ray Warburton (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A15057_F ACATTTGGCAATGTGTGGAG
Reverse Primer: A15057_R TCTCAAGCCACACCTGTCAC
Reviews

Customers who bought this product also purchased
A15058
A15058
A15056
A15056
A15055
A15055
A15054
A15054
A11378
A11378
A15060
A15060
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies