Top » Catalog » SNPs » A15057

$18.00

A15057
[A15057]

A15057
hg38 Position: ChrY:14665456..14665456
Ancestral: G
Derived: T
Reference: Ray Warburton (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A15057_F ACATTTGGCAATGTGTGGAG
Reverse Primer: A15057_R TCTCAAGCCACACCTGTCAC
Reviews

Customers who bought this product also purchased
A15056
A15056
A15055
A15055
A15054
A15054
A11378
A11378
A15060
A15060
R1b-A11378 Panel
R1b-A11378 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies