Top » Catalog » SNPs » A15058

$18.00

A15058
[A15058]

A15058
hg38 Position: ChrY:14789909..14789909
Ancestral: A
Derived: C
Reference: Ray Warburton (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A15058_F TATGCCTGGCCTATTTGTCC
Reverse Primer: A15058_R TCAGTGCCCAGTTATGTTCC
Reviews

Customers who bought this product also purchased
A15054
A15054
A11378
A11378
A15060
A15060
R1b-A11378 Panel
R1b-A11378 Panel
A15057
A15057
A15056
A15056
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies