Top » Catalog » SNPs » A15058

$18.00

A15058
[A15058]

A15058
hg38 Position: ChrY:14789909..14789909
Ancestral: A
Derived: C
Reference: Ray Warburton (2017)
ISOGG Haplogroup: R1b
Comments: .
Forward Primer: A15058_F TATGCCTGGCCTATTTGTCC
Reverse Primer: A15058_R TCAGTGCCCAGTTATGTTCC
Reviews

Customers who bought this product also purchased
A15057
A15057
A15056
A15056
A15055
A15055
A15054
A15054
A11378
A11378
A15060
A15060
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies