Top » Catalog » SNPs » Y25813

$18.00

Y25813
[Y25813]

Y25813
hg38 Position: ChrY:6930009..6930009
Ancestral: C
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: J2a1b (unlisted)
Comments: Below Y13640
Forward Primer: Y25813_F ATCTCGTTTCATGCACCTGTC
Reverse Primer: Y25813_R CAACTCTGGTGCAGGCTTC
Reviews

Customers who bought this product also purchased
Y13640
Y13640
Z467
Z467
Y13654
Y13654
M92
M92
S12459
S12459
J2a-M67 Panel
J2a-M67 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies