Top » Catalog » SNPs » Y25813

$15.00

Y25813
[Y25813]

Y25813
hg38 Position: ChrY:6930009..6930009
Ancestral: C
Derived: A
Reference: YFull (2016)
ISOGG Haplogroup: J2a1b (unlisted)
Comments: Below Y13640
Forward Primer: Y25813_F ATCTCGTTTCATGCACCTGTC
Reverse Primer: Y25813_R CAACTCTGGTGCAGGCTTC
Reviews

Customers who bought this product also purchased
CTS6804
CTS6804
Z7671
Z7671
Y13640
Y13640
Z467
Z467
Y13654
Y13654
M92
M92
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies