Top » Catalog » SNPs » A588

$18.00

A588
[A588]

A588
hg38 Position: ChrY:12038485..12038485
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30+. Z2-
Forward Primer: A588_F GACAAAAGAAAGAGCAAATTCCTG
Reverse Primer: A588_R CTCAGATTTCTGTTTCTCTTTGGTAAG
Reviews

Customers who bought this product also purchased
A585
A585
A593
A593
A586
A586
R1b-Z30 downstream
R1b-Z30 downstream
A592
A592
A599
A599
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies