Top » Catalog » SNPs » A590

$18.00

A590
[A590]

A590
hg38 Position: ChrY:14363972..14363972
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30+. Z2-
Forward Primer: A590_F GCTAAGGAGCCCTTGTAGCAG
Reverse Primer: A590_R TTCCACTTCTCCCTCCCTTC
Reviews

Customers who bought this product also purchased
A588
A588
A594
A594
A585
A585
A593
A593
A586
A586
R1b-Z30 downstream
R1b-Z30 downstream
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies