Top » Catalog » SNPs » A590

$18.00

A590
[A590]

A590
hg38 Position: ChrY:14363972..14363972
Ancestral: T
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c2b2a (not listed)
Comments: Downstream of Z30+. Z2-
Forward Primer: A590_F GCTAAGGAGCCCTTGTAGCAG
Reverse Primer: A590_R TTCCACTTCTCCCTCCCTTC
Reviews

Customers who bought this product also purchased
R1b-Z30 downstream
R1b-Z30 downstream
A592
A592
A599
A599
A591
A591
A597
A597
A589
A589
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A26616
1 x A20997
1 x A22232
1 x A22590
1 x A7015
$90.00
Haplogroup Info
Other products
Currencies