Top » Catalog » SNPs » Y2197

$18.00

Y2197
[Y2197]

Y2197
hg38 Position: ChrY:20792008..20792008
Ancestral: A
Derived: G
Reference: Vladimir Gurianov (2013)
ISOGG Haplogroup: Q1b1a1a1a1
Comments: Q-Y2200 level downstream of L245 Aka. FGC1933
Forward Primer: Y2197_F AGTCATGCATTGCCACAAAC
Reverse Primer: Y2197_R CTCCAGACAGGATGGCAGTC
Reviews

Customers who bought this product also purchased
L56
L56
YP1237
YP1237
Q Superclade Panel
Q Superclade Panel
YP1251
YP1251
YP4585
YP4585
L275
L275
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies