Top » Catalog » SNPs » A676

$19.00

A676
[A676]

A676
hg38 Position: ChrY:16887452..16887452
Ancestral: T
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c1a2a (not listed)
Comments: Below R-L1/S26
Forward Primer: A676_F CACACGTGGGGACTTAGCTC
Reverse Primer: A676_R TATGTCGGAGAGGGACAATG
Reviews

Customers who bought this product also purchased
A671
A671
A679
A679
Wish a SNP
Wish a SNP
A677
A677
A675
A675
A674
A674
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies