Top » Catalog » SNPs » A679

$18.00

A679
[A679]

A679
hg38 Position: ChrY:20622833..20622833
Ancestral: A
Derived: G
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a2a1a1c1a2a (not listed)
Comments: Below R-L1/S26
Forward Primer: A679_F CATCAGTGGCAACAGACTCC
Reverse Primer: A679_R CCAAGGCAGACAGTTTGAGC
Reviews

Customers who bought this product also purchased
A673
A673
A671
A671
A677
A677
Wish a SNP
Wish a SNP
A676
A676
A675
A675
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies