Top » Catalog » SNPs » A680

$18.00

A680
[A680]

A680
hg38 Position: ChrY:12017889..12017889
Ancestral: A
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a1c1a2a~
Comments: Downstream of L1 > A412/A415/A531
Forward Primer: A680_F TCTTCTGCTGTAGAATTCCAGCT
Reverse Primer: A680_R GCCTGAAAGTGTGGTGGTG
Reviews

Customers who bought this product also purchased
S1791
S1791
R1b-U106 Superclade Panel
R1b-U106 Superclade Panel
A671
A671
Z301
Z301
L1
L1
A410
A410
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies