Top » Catalog » SNPs » Y2200

$18.00

Y2200
[Y2200]

Y2200
hg38 Position: ChrY:20426712..20426712
Ancestral: C
Derived: T
Reference: Vladimir Gurianov (2013)
ISOGG Haplogroup: Q1b1a1a1a1
Comments: Q-Y2200 level downstream of L245 Aka. FGC1929
Forward Primer: Y2200_F AAGCTGGCTCAGAAAATAGCC
Reverse Primer: Y2200_R GTGGCTTTTAAACCCTGTGC
Reviews

Customers who bought this product also purchased
YP3943
YP3943
YP3941
YP3941
YP755
YP755
M25
M25
M242
M242
L56
L56
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies