Top » Catalog » SNPs » A692

$18.00

A692
[A692]

A692
hg38 Position: ChrY:21035051..21035051
Ancestral: A
Derived: T
Reference: Steve Louis (2014)
ISOGG Haplogroup: R2a (not listed)
Comments: below F1758. aka SL2
Forward Primer: SL2_F AGAATTCTTGAAAATGGGTGG
Reverse Primer: SL2_R TGTCAAGAAACTGCTTCTCTGTTC
Reviews

Customers who bought this product also purchased
FGC13203
FGC13203
FGC12615
FGC12615
R2-M479 Panel
R2-M479 Panel
BY14642
BY14642
FGC13184
FGC13184
F1092
F1092
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies