Top » Catalog » SNPs » FGC19641

$19.00

FGC19641
[FGC19641]

FGC19641
hg38 Position: ChrY:20542356..20542356
Ancestral: C
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: downstream of R1b L21 S691
Forward Primer: FGC19641_F TACAAGGAGCTAGGAGGAGGTC
Reverse Primer: FGC19641_R AGTCTACCTTTCTCCCTTCCATC
Reviews

Customers who bought this product also purchased
FGC19639
FGC19639
FGC19638
FGC19638
FGC19636
FGC19636
FGC19643
FGC19643
FGC19635
FGC19635
FGC19642
FGC19642
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
Currencies