Top » Catalog » SNPs » FGC21219

$18.00

FGC21219
[FGC21219]

FGC21219
hg38 Position: ChrY:8373341..8373341
Ancestral: C
Derived: T
Reference: Full Genomes Corp. (2014)
ISOGG Haplogroup: not listed
Comments: .
Forward Primer: FGC21219_F GTCACCTAGGTTTTCACTTAGTGGTAG
Reverse Primer: FGC21219_R GGAGATATTTTGACTCTCACCATTG
Reviews

Customers who bought this product also purchased
A19095
A19095
FGC21235
FGC21235
A19137
A19137
FGC21223
FGC21223
A19083
A19083
FGC21234
FGC21234
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies