Top » Catalog » SNPs » A625

$18.00

A625
[A625]

A625
hg38 Position: ChrY:12653581..12653581
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2~
Comments: Downstream of CTS6889 / CTS11824
Forward Primer: A625_F TGTGAGCCACTGTACCCAGTC
Reverse Primer: A625_R GTGCAAAACTTACACTCTCAAAGTG
Reviews

Customers who bought this product also purchased
A639
A639
A605
A605
A632
A632
A638
A638
A125
A125
A631
A631
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC52628
1 x M310.2
1 x BY1434
1 x A21223
1 x BY113517
1 x CTS1616
1 x FGC5674
1 x FGC681
$144.00
Haplogroup Info
Other products
Currencies