Top » Catalog » SNPs » A625

$18.00

A625
[A625]

A625
hg38 Position: ChrY:12653581..12653581
Ancestral: G
Derived: A
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2~
Comments: Downstream of CTS6889 / CTS11824
Forward Primer: A625_F TGTGAGCCACTGTACCCAGTC
Reverse Primer: A625_R GTGCAAAACTTACACTCTCAAAGTG
Reviews

Customers who bought this product also purchased
A632
A632
A638
A638
A125
A125
A631
A631
A637
A637
R1b-CTS6889 / CTS11824 downstream
R1b-CTS6889 / CTS11824 downstream
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies