Top » Catalog » SNPs » A613

$18.00

A613
[A613]

A613
hg38 Position: ChrY:8599304..8599304
Ancestral: G
Derived: C
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b (not listed)
Comments: Downstream of CTS6889 / CTS11824
Forward Primer: A613_F CATCCAAAATACCTCGACAGC
Reverse Primer: A613_R TTCACGGAGTTCTCCTCCC
Reviews

Customers who bought this product also purchased
A633
A633
A639
A639
A605
A605
A632
A632
A638
A638
A125
A125
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies