Top » Catalog » SNPs » S9342

$18.00

S9342
[S9342]

S9342
hg38 Position: ChrY:6830392..6830392
Ancestral: A
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: R1b1a1a2a1a1c2b2a1b6
Comments: Below Z2
Forward Primer: S9342_F CAACCATAGCTCTGCACTGTCT
Reverse Primer: S9342_R CCTATTTGCAATTGAATAACTCCAT
Reviews

Customers who bought this product also purchased
S511
S511
MZ9
MZ9
Y31374
Y31374
PH765
PH765
S272
S272
S515
S515
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies