Top » Catalog » SNPs » V13

$18.00

V13
[V13]

V13
HG19 Position: ChrY:6842263..6842263
Ancestral: G
Derived: A
Reference: Cruciani et al. (Univ. La Sapienza)
ISOGG Haplogroup: E1b1b1a1b
Comments: TBL1Y
Forward Primer: V13_F TACACTTCCAAGGCCCTGAC
Reverse Primer: V13_R GTATCAACAATGCCCAGTGG
Reviews

Customers who bought this product also purchased
P177
P177
Y16563
Y16563
FGC37180
FGC37180
E Superclade Panel
E Superclade Panel
V22
V22
FGC37187
FGC37187
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A14637
1 x HVR2
1 x mtComplete
1 x HVR1
$247.00
Haplogroup Info
Other products
Currencies