Top » Catalog » SNPs » V13

$18.00

V13
[V13]

V13
hg38 Position: ChrY:6974222..6974222
Ancestral: G
Derived: A
Reference: Cruciani et al. (Univ. La Sapienza)
ISOGG Haplogroup: E1b1b1a1b1a
Comments: TBL1Y
Forward Primer: V13_F TACACTTCCAAGGCCCTGAC
Reverse Primer: V13_R GTATCAACAATGCCCAGTGG
Reviews

Customers who bought this product also purchased
BY9972
BY9972
PF6788
PF6788
MZ143
MZ143
MZ89
MZ89
A2227
A2227
BY9980
BY9980
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies