Top » Catalog » SNPs » V13

$18.00

V13
[V13]

V13
HG19 Position: ChrY:6842263..6842263
Ancestral: G
Derived: A
Reference: Cruciani et al. (Univ. La Sapienza)
ISOGG Haplogroup: E1b1b1a1b
Comments: TBL1Y
Forward Primer: V13_F TACACTTCCAAGGCCCTGAC
Reverse Primer: V13_R GTATCAACAATGCCCAGTGG
Reviews

Customers who bought this product also purchased
M78
M78
BY6697
BY6697
M215
M215
Y16536
Y16536
P177
P177
Y16563
Y16563
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies