Top » Catalog » SNPs » V13

$18.00

V13
[V13]

V13
hg38 Position: ChrY:6974222..6974222
Ancestral: G
Derived: A
Reference: Cruciani et al. (Univ. La Sapienza)
ISOGG Haplogroup: E1b1b1a1b1a
Comments: TBL1Y
Forward Primer: V13_F TACACTTCCAAGGCCCTGAC
Reverse Primer: V13_R GTATCAACAATGCCCAGTGG
Reviews

Customers who bought this product also purchased
Z834
Z834
V12
V12
Z1902
Z1902
M35
M35
PH1246
PH1246
Z1057
Z1057
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies