Top » Catalog » SNPs » V13

$18.00

V13
[V13]

V13
hg38 Position: ChrY:6974222..6974222
Ancestral: G
Derived: A
Reference: Cruciani et al. (Univ. La Sapienza)
ISOGG Haplogroup: E1b1b1a1b1a
Comments: TBL1Y
Forward Primer: V13_F TACACTTCCAAGGCCCTGAC
Reverse Primer: V13_R GTATCAACAATGCCCAGTGG
Reviews

Customers who bought this product also purchased
M410
M410
BY40504
BY40504
Y146090
Y146090
Z37875
Z37875
Y173827
Y173827
FGC47707
FGC47707
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies