Top » Catalog » SNPs » V13

$18.00

V13
[V13]

V13
hg38 Position: ChrY:6974222..6974222
Ancestral: G
Derived: A
Reference: Cruciani et al. (Univ. La Sapienza)
ISOGG Haplogroup: E1b1b1a1b1a
Comments: TBL1Y
Forward Primer: V13_F TACACTTCCAAGGCCCTGAC
Reverse Primer: V13_R GTATCAACAATGCCCAGTGG
Reviews

Customers who bought this product also purchased
L17
L17
A2192
A2192
Y145455
Y145455
BY159269
BY159269
BY189808
BY189808
Z17293
Z17293
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies