Top » Catalog » SNPs » V13

$18.00

V13
[V13]

V13
hg38 Position: ChrY:6974222..6974222
Ancestral: G
Derived: A
Reference: Cruciani et al. (Univ. La Sapienza)
ISOGG Haplogroup: E1b1b1a1b1a
Comments: TBL1Y
Forward Primer: V13_F TACACTTCCAAGGCCCTGAC
Reverse Primer: V13_R GTATCAACAATGCCCAGTGG
Reviews

Customers who bought this product also purchased
Z1231
Z1231
PF2287
PF2287
V4083
V4083
PF2282
PF2282
Z21238
Z21238
BY5354
BY5354
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies