Top » Catalog » SNPs » FGC17603

$18.00

FGC17603
[FGC17603]

FGC17603
hg38 Position: ChrY:13592135..13592135
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L1335 > S764 > Z17612
Forward Primer: FGC17603_F CTGCATCATCCTGGTAAACAAG
Reverse Primer: FGC17603_R CATCCAGAGCACATAAACAACG
Reviews

Customers who bought this product also purchased
BY39171
BY39171
BY39170
BY39170
BY39169
BY39169
A19400
A19400
BY39168
BY39168
BY41059
BY41059
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies