Top » Catalog » SNPs » FGC17603

$18.00

FGC17603
[FGC17603]

FGC17603
hg38 Position: ChrY:13592135..13592135
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b (not listed)
Comments: Below L1335 > S764 > Z17612
Forward Primer: FGC17603_F CTGCATCATCCTGGTAAACAAG
Reverse Primer: FGC17603_R CATCCAGAGCACATAAACAACG
Reviews

Customers who bought this product also purchased
FGC19782
FGC19782
FGC19785
FGC19785
Z17613
Z17613
BY150
BY150
S7364
S7364
BY3144
BY3144
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies