Top » Catalog » SNPs » FGC6735

$18.00

FGC6735
[FGC6735]

FGC6735
hg38 Position: ChrY:8178255..8178255
Ancestral: C
Derived: A
Reference: Greg Magoon (FGC 2013)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream from J2-PF5456
Forward Primer: FGC6735_F AGGCCTGGTTCCTTCTTCTC
Reverse Primer: FGC6735_R TGCCACTGGGCAGTTTAAG
Reviews

Customers who bought this product also purchased
PH2725
PH2725
FGC9927
FGC9927
Z41168
Z41168
L70
L70
Z40776
Z40776
J2a-L24 Panel
J2a-L24 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies