Top » Catalog » SNPs » FGC6735

$18.00

FGC6735
[FGC6735]

FGC6735
hg38 Position: ChrY:8178255..8178255
Ancestral: C
Derived: A
Reference: Greg Magoon (FGC 2013)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream from J2-PF5456
Forward Primer: FGC6735_F AGGCCTGGTTCCTTCTTCTC
Reverse Primer: FGC6735_R TGCCACTGGGCAGTTTAAG
Reviews

Customers who bought this product also purchased
L26
L26
Z32091
Z32091
FGC9927
FGC9927
Z41168
Z41168
L70
L70
Z40776
Z40776
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies