Top » Catalog » SNPs » FGC6759

$18.00

FGC6759
[FGC6759]

FGC6759
hg38 Position: ChrY:21118987..21118987
Ancestral: G
Derived: T
Reference: Greg Magoon (FGC 2013)
ISOGG Haplogroup: J2 (not listed)
Comments: Downstream from J2-PF5456
Forward Primer: FGC6759_F AGGGGCTCACATAACACAAAC
Reverse Primer: FGC6759_R GAGCAGAGAAACATGCTGGAC
Reviews

Customers who bought this product also purchased
FGC6752
FGC6752
FGC6734
FGC6734
FGC6743
FGC6743
FGC6751
FGC6751
A702
A702
FGC6742
FGC6742
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies