Top » Catalog » SNPs » S1961

$18.00

S1961
[S1961]

S1961
hg38 Position: ChrY:15466065..15466065
Ancestral: C
Derived: T
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I1a2a1a1a1 (not listed)
Comments: Below A376. parallel to A264
Forward Primer: S1961_F CCTATCAGAGAGGCACCAGTG
Reverse Primer: S1961_R GCTTGTCAGCTCCCTTAGGTG
Reviews

Customers who bought this product also purchased
YFS251206
YFS251206
S2000
S2000
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies