Top » Catalog » SNPs » Y2633

$18.00

Y2633
[Y2633]

Y2633
hg38 Position: ChrY:15421171..15421171
Ancestral: C
Derived: A
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b2a2b (not listed)
Comments: Aka SUR22. Below Z2123 > Y20746 > Y2632
Forward Primer: Y2633_F AAATCAGGTACCCTGAGATTTGG
Reverse Primer: Y2633_R CATACTGCAGCCAGGATGG
Reviews

Customers who bought this product also purchased
SUR51
SUR51
R1a-Z93 Panel
R1a-Z93 Panel
Y2632
Y2632
Y20746
Y20746
Y934
Y934
YP5717
YP5717
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies