Top » Catalog » SNPs » Y2633

$18.00

Y2633
[Y2633]

Y2633
hg38 Position: ChrY:15421171..15421171
Ancestral: C
Derived: A
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b2a2b (not listed)
Comments: Aka SUR22. Below Z2123 > Y20746 > Y2632
Forward Primer: Y2633_F AAATCAGGTACCCTGAGATTTGG
Reverse Primer: Y2633_R CATACTGCAGCCAGGATGG
Reviews

Customers who bought this product also purchased
Y20746
Y20746
Y934
Y934
YP5717
YP5717
Z2123
Z2123
Y79089
Y79089
Z2124
Z2124
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies