Top » Catalog » SNPs » Y934

$18.00

Y934
[Y934]

Y934
hg38 Position: ChrY:12162678..12162679
Ancestral: ins
Derived: del
Reference: Semargl (2013)
ISOGG Haplogroup: R1a1a1b2a2a (not listed)
Comments: Aka KMS3
Forward Primer: Y934_F TGTATATGGAGAAAAGATAGGCAAAG
Reverse Primer: Y934_R GTGTCCCTGCCCAAATACC
Reviews

Customers who bought this product also purchased
YP4907
YP4907
L62
L62
R1a Superclade Panel
R1a Superclade Panel
YP524
YP524
YP5908
YP5908
Y15121
Y15121
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies