Top » Catalog » SNPs » FGC17455

$18.00

FGC17455
[FGC17455]

FGC17455
hg38 Position: ChrY:16657408..16657408
Ancestral: A
Derived: T
Reference: Full Genomes Corp (2014)
ISOGG Haplogroup: R1b1a2a1a2c1f (not listed)
Comments: .
Forward Primer: FGC17455_F AGGCTGATGTTGGGAGGAG
Reverse Primer: FGC17455_R TTTGATGTCAGGAGTGCAAG
Reviews

Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies