Top » Catalog » SNPs » A431

$18.00

A431
[A431]

A431
hg38 Position: ChrY:8595740..8595740
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2a4
Comments: Approx. DF27
Forward Primer: A431_F AACCCCTCCACTTCCAATG
Reverse Primer: A431_R CCACGGATCCCAAAGAGAAC
Reviews

Customers who bought this product also purchased
DF83
DF83
Z2563
Z2563
FGC23079
FGC23079
S9355
S9355
DF19
DF19
Y18292
Y18292
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies