Top » Catalog » SNPs » A431

$18.00

A431
[A431]

A431
hg38 Position: ChrY:8595740..8595740
Ancestral: G
Derived: T
Reference: YSEQ (2016)
ISOGG Haplogroup: R1b1a1a2a1a2a4
Comments: Approx. DF27
Forward Primer: A431_F AACCCCTCCACTTCCAATG
Reverse Primer: A431_R CCACGGATCCCAAAGAGAAC
Reviews

Customers who bought this product also purchased
A11625
A11625
BY129286
BY129286
A11632
A11632
BY16029
BY16029
FT65663
FT65663
BY21429
BY21429
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies