Top » Catalog » SNPs » DF81

$18.00

DF81
[DF81]

DF81
hg38 Position: ChrY:7321512..7321512
Ancestral: G
Derived: A
Reference: Gregory Magoon (2012)
ISOGG Haplogroup: R1b1a1a2a1a2a7~
Comments: downstream of DF27
Forward Primer: DF81_F GCCAGTCTTAGTGGCATGTG
Reverse Primer: DF81_R CTGCAAGGATGCTGGAGTTC
Reviews

Customers who bought this product also purchased
S2292
S2292
Y134946
Y134946
A15900
A15900
SK2109
SK2109
Y5075
Y5075
Y152744
Y152744
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies