Top » Catalog » SNPs » Z225

$18.00

Z225
[Z225]

Z225
hg38 Position: ChrY:8735355..8735355
Ancestral: A
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2a5
Comments: Below DF27
Forward Primer: Z225_F CCTGAGAGAATGAGCTGTTG
Reverse Primer: Z225_R GTGTGGAATTTGGCCTCCAG
Reviews

Customers who bought this product also purchased
DF19
DF19
U152
U152
Y18292
Y18292
P312
P312
A434
A434
L21
L21
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies