Top » Catalog » SNPs » Z225

$15.00

Z225
[Z225]

Z225
hg38 Position: ChrY:8735355..8735355
Ancestral: A
Derived: G
Reference: http://dna-forums.org/
ISOGG Haplogroup: R1b1a1a2a1a2a5
Comments: Below DF27
Forward Primer: Z225_F CCTGAGAGAATGAGCTGTTG
Reverse Primer: Z225_R GTGTGGAATTTGGCCTCCAG
Reviews

Customers who bought this product also purchased
FGC23079
FGC23079
S9355
S9355
A7014
A7014
PH2047
PH2047
DF19
DF19
R1b-M343 Orientation Panel
R1b-M343 Orientation Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies